Probe CUST_23939_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_23939_PI426222305 JHI_St_60k_v1 DMT400083788 GAGCCATTTGTTGTTTAATTCTACTTTGTTTCTGTTGGCATGAAGACTGTTGTGTGATTA

All Microarray Probes Designed to Gene DMG400033586

Probe IDChip nameTranscript IDProbe Sequence
CUST_23939_PI426222305 JHI_St_60k_v1 DMT400083788 GAGCCATTTGTTGTTTAATTCTACTTTGTTTCTGTTGGCATGAAGACTGTTGTGTGATTA


Microarray Signals from CUST_23939_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1358.42218.0580.9294480.130544
ABA 1h3308.53469.8172.573070.303208
ACC 1h1382.81107.2630.9409750.0544288
BABA 1h1197.2969.2760.8729820.0750756
Chitin 1h1386.56466.0830.9725130.252507
Epi 1h1150.42299.0630.8700910.245679
SA 1h991.455188.1330.6559770.116055
Me-JA 1h641.554169.5590.5098730.200848
Control 6h1514.39374.2380.9813350.208719
ABA 6h7857.91562.5395.169840.652666
ACC 6h1759.41221.3821.061980.0613683
BABA 6h2258.5231.4591.403010.163773
Chitin 6h1633.17218.5831.058680.175783
Epi 6h1694.4898.25381.053330.132024
SA 6h1195.05203.7130.8218430.0611478
Me-JA 6h2056.92872.3921.233340.441519

Source Transcript PGSC0003DMT400083788 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G58120.1 +1 9e-55 192 158/396 (40%) BEST Arabidopsis thaliana protein match is: methyltransferases (TAIR:AT5G01710.1); Has 93 Blast hits to 93 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:21520962-21522224 FORWARD LENGTH=420

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083788

Click here to view details at Spud DB Genome Browser (opens in new window)