Probe CUST_19967_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_19967_PI426222305 JHI_St_60k_v1 DMT400049196 TTGTGGCTTGTGGTGAAGGACTAAGGTCTTTGATGGCTATTTCAAAGTTACATGAAGGAG

All Microarray Probes Designed to Gene DMG400019121

Probe IDChip nameTranscript IDProbe Sequence
CUST_20048_PI426222305 JHI_St_60k_v1 DMT400049195 CATCTGTGAAACTTGGAACTCCGTGCTTATTTTCAATATAATGTTGGTATATCTCCATTG
CUST_19967_PI426222305 JHI_St_60k_v1 DMT400049196 TTGTGGCTTGTGGTGAAGGACTAAGGTCTTTGATGGCTATTTCAAAGTTACATGAAGGAG


Microarray Signals from CUST_19967_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h2507.93269.7531.034880.0597654
ABA 1h2216.59522.3390.991810.188329
ACC 1h2736.13437.5531.084470.105647
BABA 1h2477.33451.3531.031090.103899
Chitin 1h2457.79142.3381.137470.0717064
Epi 1h2006.85277.4170.9479230.120159
SA 1h2731.57346.911.092930.0945021
Me-JA 1h1887.86109.1590.9641060.0581532
Control 6h3129.45867.2371.179240.304478
ABA 6h1420.7582.35670.5560620.0321378
ACC 6h1814.58517.7080.6076580.102223
BABA 6h3065.41575.3281.105860.207123
Chitin 6h2800.5162.2451.094510.0632113
Epi 6h2827.44163.8121.04330.100057
SA 6h2108.6545.7960.8134090.167054
Me-JA 6h900.913326.7960.3260390.108195

Source Transcript PGSC0003DMT400049196 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G08920.1 +1 2e-82 252 122/186 (66%) Rhodanese/Cell cycle control phosphatase superfamily protein | chr3:2712274-2713117 FORWARD LENGTH=214

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400049196

Click here to view details at Spud DB Genome Browser (opens in new window)