Probe CUST_19026_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_19026_PI426222305 JHI_St_60k_v1 DMT400044674 GGATAAGCCAAATTAGTGTTAAGAGTTCTCTGTATTCCTTCATTTCTCTTCTTCTCTGTA

All Microarray Probes Designed to Gene DMG400017331

Probe IDChip nameTranscript IDProbe Sequence
CUST_19026_PI426222305 JHI_St_60k_v1 DMT400044674 GGATAAGCCAAATTAGTGTTAAGAGTTCTCTGTATTCCTTCATTTCTCTTCTTCTCTGTA


Microarray Signals from CUST_19026_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h43.49116.781.081540.344617
ABA 1h84.091624.55092.487450.897647
ACC 1h145.60421.47533.952130.896146
BABA 1h49.18137.064191.418120.133538
Chitin 1h65.049626.70671.76550.780517
Epi 1h52.91485.347551.721690.191203
SA 1h76.083722.66711.867410.63366
Me-JA 1h35.463712.57041.023180.485071
Control 6h6.178853.542340.1750140.10029
ABA 6h858.948337.33919.83136.92358
ACC 6h12.26044.208290.2831870.110771
BABA 6h24.795212.48250.4600070.355884
Chitin 6h6.709643.892790.1791720.103891
Epi 6h11.31014.338090.2480350.115447
SA 6h6.330693.671260.1820360.105557
Me-JA 6h6.016613.491610.171540.0993533

Source Transcript PGSC0003DMT400044674 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G78830.1 +3 3e-34 134 111/342 (32%) Curculin-like (mannose-binding) lectin family protein | chr1:29637141-29638508 REVERSE LENGTH=455

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400044674

Click here to view details at Spud DB Genome Browser (opens in new window)