Probe CUST_17403_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_17403_PI426222305 | JHI_St_60k_v1 | DMT400008182 | CTACGCAAAGTCCGTAATTGTATCGAAGATCACTTATGCTAAAAGTCTTTAACAGTATTG |
All Microarray Probes Designed to Gene DMG400003155
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_17403_PI426222305 | JHI_St_60k_v1 | DMT400008182 | CTACGCAAAGTCCGTAATTGTATCGAAGATCACTTATGCTAAAAGTCTTTAACAGTATTG |
Microarray Signals from CUST_17403_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 3652.71 | 472.494 | 2.1764 | 0.137524 |
ABA 1h | 2383.38 | 147.41 | 1.62602 | 0.093906 |
ACC 1h | 3493.91 | 1133.54 | 1.75597 | 0.69998 |
BABA 1h | 2309.3 | 493.284 | 1.37411 | 0.195272 |
Chitin 1h | 1411 | 193.238 | 0.93101 | 0.0783858 |
Epi 1h | 2144.38 | 124.085 | 1.49835 | 0.0988744 |
SA 1h | 3226.17 | 782.606 | 1.7704 | 0.438696 |
Me-JA 1h | 977.221 | 56.5375 | 0.725186 | 0.05592 |
Control 6h | 2276.48 | 619.925 | 1.28434 | 0.287011 |
ABA 6h | 799.621 | 57.8411 | 0.453339 | 0.0262604 |
ACC 6h | 1865.52 | 299.953 | 0.956581 | 0.192668 |
BABA 6h | 1396.96 | 158.718 | 0.745692 | 0.0599396 |
Chitin 6h | 923.963 | 53.6109 | 0.524721 | 0.030698 |
Epi 6h | 1522.48 | 142.009 | 0.81111 | 0.114498 |
SA 6h | 1790.14 | 335.343 | 1.0598 | 0.119852 |
Me-JA 6h | 1400.35 | 465.777 | 0.757259 | 0.26754 |
Source Transcript PGSC0003DMT400008182 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT1G65060.1 | +2 | 0.0 | 682 | 372/535 (70%) | 4-coumarate:CoA ligase 3 | chr1:24167385-24171457 REVERSE LENGTH=561 |