Probe CUST_17276_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_17276_PI426222305 JHI_St_60k_v1 DMT400057934 CTTAAGAGGATGGTTCTCAGTTCATCAGAATTGTTCAGCTCTGGTTGTATCTCTTCCGAT

All Microarray Probes Designed to Gene DMG400022500

Probe IDChip nameTranscript IDProbe Sequence
CUST_17276_PI426222305 JHI_St_60k_v1 DMT400057934 CTTAAGAGGATGGTTCTCAGTTCATCAGAATTGTTCAGCTCTGGTTGTATCTCTTCCGAT


Microarray Signals from CUST_17276_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h13.13034.305370.8205110.292964
ABA 1h10.28233.310290.7549850.302051
ACC 1h12.73063.697850.8411750.278555
BABA 1h10.8833.590820.7499020.290798
Chitin 1h7.280733.417180.5658670.273119
Epi 1h13.66673.406881.052570.306712
SA 1h10.52794.894330.6026150.278895
Me-JA 1h7.896683.480980.6586980.322101
Control 6h21.19485.204621.426560.300136
ABA 6h20.02073.85051.314150.267479
ACC 6h36.124812.67342.017820.386247
BABA 6h20.0154.176951.268110.266724
Chitin 6h11.69113.95810.7258430.294316
Epi 6h15.43778.346080.7406290.448983
SA 6h8.233653.764960.5890960.277845
Me-JA 6h19.80457.274551.244050.455009

Source Transcript PGSC0003DMT400057934 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G30230.2 +1 3e-85 261 187/230 (81%) Glutathione S-transferase, C-terminal-like;Translation elongation factor EF1B/ribosomal protein S6 | chr1:10639286-10640601 FORWARD LENGTH=260

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400057934

Click here to view details at Spud DB Genome Browser (opens in new window)