Probe CUST_16496_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_16496_PI426222305 JHI_St_60k_v1 DMT400069306 GTGCATGCTACTATGATGAACAACCTAATAATGTGAAAGTGAAATCTCTTGTGGTATGAA

All Microarray Probes Designed to Gene DMG400026959

Probe IDChip nameTranscript IDProbe Sequence
CUST_16496_PI426222305 JHI_St_60k_v1 DMT400069306 GTGCATGCTACTATGATGAACAACCTAATAATGTGAAAGTGAAATCTCTTGTGGTATGAA
CUST_16802_PI426222305 JHI_St_60k_v1 DMT400069305 TCTCATCATGACCAAAATATTCATCTCAAGTATAGTACTTGCCCAACATCACTACACTAG


Microarray Signals from CUST_16496_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h351.18144.2541.302970.0901567
ABA 1h265.32115.73591.129490.0819256
ACC 1h250.51629.41150.9052640.0547144
BABA 1h307.13128.90151.188680.0703997
Chitin 1h301.24232.53341.247720.077044
Epi 1h262.67952.77741.091470.22571
SA 1h245.79418.95420.8953730.090153
Me-JA 1h99.22536.840930.4576380.0351493
Control 6h344.159109.8661.129440.371408
ABA 6h278.31759.29490.94130.243247
ACC 6h363.86577.86631.128620.217933
BABA 6h351.39324.81061.175930.103553
Chitin 6h257.40917.61270.9065230.0690754
Epi 6h295.00528.47130.9757120.0582659
SA 6h240.1424.97690.9035930.0545126
Me-JA 6h188.15135.45910.6881070.118587

Source Transcript PGSC0003DMT400069306 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G01940.3 +1 2e-131 394 224/402 (56%) C2H2-like zinc finger protein | chr2:432652-434917 FORWARD LENGTH=446

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400069306

Click here to view details at Spud DB Genome Browser (opens in new window)