Probe CUST_15175_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_15175_PI426222305 | JHI_St_60k_v1 | DMT400057213 | GAATGGATCGAAGAAACTGAGATACAATCAATTCCTGCTTCACATTGAATTCAATTACAG |
All Microarray Probes Designed to Gene DMG400022225
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_15175_PI426222305 | JHI_St_60k_v1 | DMT400057213 | GAATGGATCGAAGAAACTGAGATACAATCAATTCCTGCTTCACATTGAATTCAATTACAG |
Microarray Signals from CUST_15175_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 2283.88 | 497.981 | 5.02432 | 0.776081 |
ABA 1h | 1646.15 | 498.624 | 3.8941 | 1.55924 |
ACC 1h | 2394.55 | 138.466 | 5.37424 | 0.310449 |
BABA 1h | 1110.85 | 298.757 | 2.41148 | 0.573477 |
Chitin 1h | 746.52 | 143.729 | 1.8322 | 0.299761 |
Epi 1h | 1130.85 | 77.0828 | 3.00108 | 0.269408 |
SA 1h | 740.296 | 175.182 | 1.55514 | 0.337575 |
Me-JA 1h | 336.524 | 51.8252 | 0.927545 | 0.0701393 |
Control 6h | 493.105 | 113.663 | 1.07358 | 0.187181 |
ABA 6h | 102.166 | 16.2279 | 0.216383 | 0.0409123 |
ACC 6h | 465.198 | 71.4836 | 0.914777 | 0.053438 |
BABA 6h | 293.135 | 64.9683 | 0.576459 | 0.133586 |
Chitin 6h | 485.152 | 128.376 | 0.986028 | 0.228499 |
Epi 6h | 275.328 | 27.1069 | 0.558263 | 0.0632278 |
SA 6h | 403.023 | 54.1217 | 0.921322 | 0.0540263 |
Me-JA 6h | 219.736 | 34.7351 | 0.495488 | 0.112051 |
Source Transcript PGSC0003DMT400057213 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | None | - | - | - | - | - |
TAIR PP10 | AT4G27030.1 | +2 | 4e-124 | 365 | 172/299 (58%) | fatty acid desaturase A | chr4:13571951-13572922 FORWARD LENGTH=323 |