Probe CUST_13458_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_13458_PI426222305 JHI_St_60k_v1 DMT400017633 AACAAAATGGCAACCACACTGTTCGGAGTCCTATAGTGACATCTACCATTATTGAGGTCT

All Microarray Probes Designed to Gene DMG400006840

Probe IDChip nameTranscript IDProbe Sequence
CUST_13578_PI426222305 JHI_St_60k_v1 DMT400017634 CATTATTGAGGTCTGGGGTAGCGAAGACTAAGGGGGAAATAAGAAACACATTATATAAGG
CUST_13458_PI426222305 JHI_St_60k_v1 DMT400017633 AACAAAATGGCAACCACACTGTTCGGAGTCCTATAGTGACATCTACCATTATTGAGGTCT


Microarray Signals from CUST_13458_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h1317.24214.120.8907830.101662
ABA 1h961.691149.9860.7360880.0614008
ACC 1h1220.39255.9580.7814420.131012
BABA 1h1476.16392.9440.9711210.212401
Chitin 1h1099.86199.9890.8224550.0955044
Epi 1h993.846107.410.7860380.0759534
SA 1h1500.12347.190.9626180.158355
Me-JA 1h483.36445.56550.4065430.023614
Control 6h1819.85425.931.173480.222118
ABA 6h3552.68882.7882.145350.540143
ACC 6h3484.64206.5912.09850.16868
BABA 6h2721.81593.5731.613950.292173
Chitin 6h1502.6298.16630.9741710.0704478
Epi 6h1974.97256.8491.192580.112955
SA 6h1837.85170.761.276160.0737159
Me-JA 6h1509.94324.6061.002590.136166

Source Transcript PGSC0003DMT400017633 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G34980.1 +1 2e-59 204 120/289 (42%) subtilisin-like serine protease 2 | chr4:16656929-16659223 REVERSE LENGTH=764

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400017633

Click here to view details at Spud DB Genome Browser (opens in new window)