Probe CUST_12536_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_12536_PI426222305 JHI_St_60k_v1 DMT400063776 GCCCCATTGTACATTTTCTGTCATTACACTTCGTGGTATATAAACATATAGCTGTACATT

All Microarray Probes Designed to Gene DMG400024785

Probe IDChip nameTranscript IDProbe Sequence
CUST_12612_PI426222305 JHI_St_60k_v1 DMT400063775 GCCCCATTGTACATTTTCTGTCATTACACTTCGTGGTATATAAACATATAGCTGTACATT
CUST_12318_PI426222305 JHI_St_60k_v1 DMT400063777 GCCCCATTGTACATTTTCTGTCATTACACTTCGTGGTATATAAACATATAGCTGTACATT
CUST_12536_PI426222305 JHI_St_60k_v1 DMT400063776 GCCCCATTGTACATTTTCTGTCATTACACTTCGTGGTATATAAACATATAGCTGTACATT


Microarray Signals from CUST_12536_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h347.28880.01241.202010.194842
ABA 1h279.98128.74181.136760.0877654
ACC 1h342.825119.1830.9954940.474391
BABA 1h268.68924.35551.004540.0813587
Chitin 1h186.86425.92050.7411410.0451514
Epi 1h201.57327.85680.8283840.116089
SA 1h393.88642.5171.375360.106073
Me-JA 1h122.38117.39340.5343380.0380169
Control 6h306.04257.11.06440.122818
ABA 6h280.13342.83140.9341020.0963743
ACC 6h257.71915.53890.8152370.0893798
BABA 6h344.49720.32641.115940.0657344
Chitin 6h258.57915.44730.8819510.0526723
Epi 6h361.25436.6441.152460.138047
SA 6h280.69741.11491.005860.0599325
Me-JA 6h238.23364.94570.8020040.168071

Source Transcript PGSC0003DMT400063776 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G18750.1 +1 2e-85 289 177/440 (40%) Calmodulin-binding protein | chr2:8125827-8128363 FORWARD LENGTH=622

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400063776

Click here to view details at Spud DB Genome Browser (opens in new window)