Probe CUST_1251_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_1251_PI426222305 JHI_St_60k_v1 DMT400001280 GCAGAAGTGTTCATTTGAACTGCTTTTTCATTTACCTCTTTTTGAACATTTCCAACCTCA

All Microarray Probes Designed to Gene DMG400000486

Probe IDChip nameTranscript IDProbe Sequence
CUST_1251_PI426222305 JHI_St_60k_v1 DMT400001280 GCAGAAGTGTTCATTTGAACTGCTTTTTCATTTACCTCTTTTTGAACATTTCCAACCTCA
CUST_863_PI426222305 JHI_St_60k_v1 DMT400001279 ATGATAAGGCTTTGAAGCTTGAAGAGTTTGGAGTGAGTGGCTCAGATGCTGAGAGTGTAT
CUST_1100_PI426222305 JHI_St_60k_v1 DMT400001281 CTTGGCCTGAAAATGGCTGCAATCTTACAAACATGTATTCTGTCTTTACAGTATATATCA


Microarray Signals from CUST_1251_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h19.10753.306821.061030.188952
ABA 1h15.11093.098040.9610470.203886
ACC 1h17.36183.496510.9288230.206927
BABA 1h10.90745.486740.5113730.246788
Chitin 1h16.58223.362551.002760.214843
Epi 1h11.32783.110460.71230.218956
SA 1h5.267723.055970.2926620.169621
Me-JA 1h9.325643.211980.60960.244008
Control 6h41.304810.10542.193480.407367
ABA 6h23.97457.936251.120550.420676
ACC 6h24.716113.96030.8376620.548299
BABA 6h42.48315.15411.811930.888879
Chitin 6h53.176615.01512.634670.734847
Epi 6h45.635819.21271.936341.00867
SA 6h16.38953.524980.9457660.203496
Me-JA 6h31.446414.24671.265711.00981

Source Transcript PGSC0003DMT400001280 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g086710.2 +2 4e-152 439 237/241 (98%) genomic_reference:SL2.50ch02 gene_region:43930486-43935980 transcript_region:SL2.50ch02:43930486..43935980+ go_terms:GO:0005524,GO:0016656 functional_description:Monodehydroascorbate reductase (NADH)-like protein (AHRD V1 **** Q0WUJ1_ARATH); contains Interpro domain(s) IPR013027 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
TAIR PP10 AT3G27820.1 +2 5e-131 385 204/241 (85%) monodehydroascorbate reductase 4 | chr3:10315249-10317881 FORWARD LENGTH=488

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001280

Click here to view details at Spud DB Genome Browser (opens in new window)