Probe CUST_11373_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_11373_PI426222305 JHI_St_60k_v1 DMT400010663 TTGGTAGCCTCTTTGCCAAGAAATAATGATCAGAGACGGATTTAGAATTTTAAGTCCATC

All Microarray Probes Designed to Gene DMG400004165

Probe IDChip nameTranscript IDProbe Sequence
CUST_11373_PI426222305 JHI_St_60k_v1 DMT400010663 TTGGTAGCCTCTTTGCCAAGAAATAATGATCAGAGACGGATTTAGAATTTTAAGTCCATC


Microarray Signals from CUST_11373_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h2193.07355.0161.270070.125967
ABA 1h1405.38208.9180.9214320.180946
ACC 1h1980.78168.4241.13650.0908852
BABA 1h1508.14256.1650.8975110.0756332
Chitin 1h1500.86109.8460.985210.117225
Epi 1h1494.1896.78381.020030.0589292
SA 1h1944.33216.7281.108870.115844
Me-JA 1h1268.0992.54590.9166530.0529736
Control 6h2171.86466.5881.228720.166443
ABA 6h431.08658.4270.2361340.0407344
ACC 6h1886.57380.2440.9386260.059868
BABA 6h2382.23211.1811.252910.131771
Chitin 6h2326.94277.5191.276760.133047
Epi 6h2196.51336.1641.125290.27873
SA 6h1454229.6470.8487680.0569184
Me-JA 6h750.756166.9980.4219560.072143

Source Transcript PGSC0003DMT400010663 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47070.1 +3 7e-16 71 41/83 (49%) LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thylakoid soluble phosphoprotein TSP9 (InterPro:IPR021584); Has 37 Blast hits to 37 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:17337205-17337507 REVERSE LENGTH=100

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400010663

Click here to view details at Spud DB Genome Browser (opens in new window)