Probe CUST_11038_PI426222305 - General Information

Probe IDChip nameTranscript IDProbe Sequence
CUST_11038_PI426222305 JHI_St_60k_v1 DMT400078541 ACGAGAAGCTACTGATATATGACTTCATTCCAAATGGAAACCTTACCACCGCAATTCACG

All Microarray Probes Designed to Gene DMG400030572

Probe IDChip nameTranscript IDProbe Sequence
CUST_11038_PI426222305 JHI_St_60k_v1 DMT400078541 ACGAGAAGCTACTGATATATGACTTCATTCCAAATGGAAACCTTACCACCGCAATTCACG
CUST_11308_PI426222305 JHI_St_60k_v1 DMT400078542 ACGAGAAGCTACTGATATATGACTTCATTCCAAATGGAAACCTTACCACCGCAATTCACG


Microarray Signals from CUST_11038_PI426222305



TreatmentRaw signalRaw Std ErrNormalized signalNormalized Std Err
Control 1h137.55436.62171.09570.211522
ABA 1h68.89365.140830.6583020.0490467
ACC 1h135.94742.46551.007080.283685
BABA 1h103.7510.96710.9031690.0626337
Chitin 1h111.8547.443871.05490.0865002
Epi 1h91.79617.025140.8957360.0626736
SA 1h92.556210.0440.7555870.0581781
Me-JA 1h51.66748.375340.5225040.0706084
Control 6h202.48454.87021.55650.393047
ABA 6h186.20511.7671.481650.0916105
ACC 6h179.63551.68991.234220.163636
BABA 6h180.05531.95621.316920.218826
Chitin 6h165.90117.02241.309720.119073
Epi 6h196.62251.06511.391760.382968
SA 6h130.74717.73771.103380.123282
Me-JA 6h143.62442.26951.098530.306241

Source Transcript PGSC0003DMT400078541 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G01210.1 +1 0.0 607 326/499 (65%) Leucine-rich repeat protein kinase family protein | chr2:119509-121734 REVERSE LENGTH=716

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078541

Click here to view details at Spud DB Genome Browser (opens in new window)