All Microarray Probes on Gene DMG400027238

Probe IDChip nameTranscript IDProbe Sequence
CUST_21421_PI426222305 JHI_St_60k_v1 DMT400070037 TGCTGTGATTAATGGATGGGAAAATGAAGAAGTTCAAAAGGCTACTTCATGGATGAAGAA
CUST_21509_PI426222305 JHI_St_60k_v1 DMT400070038 GACACGTGTTAGACAATAAATTTTCAGAATATCTTTAGTATCCGCCAAAATTTTGTGCGC


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400027238

Click here to view details at Spud DB Genome Browser (opens in new window)