All Microarray Probes on Gene DMG400027187

Probe IDChip nameTranscript IDProbe Sequence
CUST_30435_PI426222305 JHI_St_60k_v1 DMT400069918 GGAGGGAAGTGTCCACTTTGACTCTTGAATCTAAACTTAGTGCAACATTTAACTAAAGAG
CUST_30429_PI426222305 JHI_St_60k_v1 DMT400069915 CTGCATTGAGGTTCATCACAGTAGATTCCAAAACATACCATGTATTTGCTGACTTATAAT
CUST_30415_PI426222305 JHI_St_60k_v1 DMT400069916 CTGCATTGAGGTTCATCACAGTAGATTCCAAAACATACCATGTATTTGCTGACTTATAAT
CUST_30350_PI426222305 JHI_St_60k_v1 DMT400069917 CTGCATTGAGGTTCATCACAGTAGATTCCAAAACATACCATGTATTTGCTGACTTATAAT
CUST_30375_PI426222305 JHI_St_60k_v1 DMT400069914 CTGCATTGAGGTTCATCACAGTAGATTCCAAAACATACCATGTATTTGCTGACTTATAAT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400027187

Click here to view details at Spud DB Genome Browser (opens in new window)