All Microarray Probes on Gene DMG400027140

Probe IDChip nameTranscript IDProbe Sequence
CUST_30341_PI426222305 JHI_St_60k_v1 DMT400069793 GGACCATTCTACTTGCCCTCCCAAACTCCCTCCATATTTTAGTACTTTTTATGGTTTGAT
CUST_30309_PI426222305 JHI_St_60k_v1 DMT400069794 GGACCATTCTACTTGCCCTCCCAAACTCCCTCCATATTTTAGTACTTTTTATGGTTTGAT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400027140

Click here to view details at Spud DB Genome Browser (opens in new window)