All Microarray Probes on Gene DMG400025407

Probe IDChip nameTranscript IDProbe Sequence
CUST_43510_PI426222305 JHI_St_60k_v1 DMT400065364 CCTTTTCAAATTTGTATAATTTTGCATTCAGTCTCTCGTTTGTATAAGTCGTTGGTTGCC
CUST_43504_PI426222305 JHI_St_60k_v1 DMT400065366 GGATATTAATGCTGAGGTAAATTAGTTCCAACGGAGCTCTTTCTCTTCCCTTTCCGCAAC
CUST_43505_PI426222305 JHI_St_60k_v1 DMT400065365 CCTTTTCAAATTTGTATAATTTTGCATTCAGTCTCTCGTTTGTATAAGTCGTTGGTTGCC


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400025407

Click here to view details at Spud DB Genome Browser (opens in new window)