All Microarray Probes on Gene DMG400024632

Probe IDChip nameTranscript IDProbe Sequence
CUST_12890_PI426222305 JHI_St_60k_v1 DMT400063326 GATCAGCCTAATTCGAATTTGTCTTTAGAGCTTGGAGAAGGAAGAGATAAGATGCCCCTA
CUST_12949_PI426222305 JHI_St_60k_v1 DMT400063327 CTGGATTATTCATGAGCAAACATAATCATGCTACATTATTCCTTCTTCACAGGTACAACA


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400024632

Click here to view details at Spud DB Genome Browser (opens in new window)