All Microarray Probes on Gene DMG400022794

Probe IDChip nameTranscript IDProbe Sequence
CUST_44932_PI426222305 JHI_St_60k_v1 DMT400058675 CTATGGATGATCCAAGCTCAAGGTTACGGGAAATTTTAAGTATGAATGTTGATTGTATTG


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400022794

Click here to view details at Spud DB Genome Browser (opens in new window)