All Microarray Probes on Gene DMG400022624

Probe IDChip nameTranscript IDProbe Sequence
CUST_33490_PI426222305 JHI_St_60k_v1 DMT400058271 TCTCTCAACATTGTTCAGTATATTGATGAAAAATGGACTAATTCTGGTCCCTCTATTCTC
CUST_33563_PI426222305 JHI_St_60k_v1 DMT400058270 GAAGCTAGCCATGGAAACAAATTGTGTAAAGCTTCTAGGTTCATGGGCAAGCCCGTTTGT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400022624

Click here to view details at Spud DB Genome Browser (opens in new window)