All Microarray Probes on Gene DMG400016268

Probe IDChip nameTranscript IDProbe Sequence
CUST_22047_PI426222305 JHI_St_60k_v1 DMT400041940 CCTCAATTATGTGGAGTCAAGGAGTGTGTCACATAAGCCAAAAAGTGTGCAAAATTACAA
CUST_22041_PI426222305 JHI_St_60k_v1 DMT400041941 CAGTAGCATGTATCCAAACCCATAGCCGTGTATGTGTTTATTTGTTCAACTTTTACAAAT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400016268

Click here to view details at Spud DB Genome Browser (opens in new window)