All Microarray Probes on Gene DMG400015184

Probe IDChip nameTranscript IDProbe Sequence
CUST_22347_PI426222305 JHI_St_60k_v1 DMT400039271 GATTTAATGTAAGAATCCATCACCGTGATGGCTAGCTTGGCTAAAAGGTTAAATGAAAAA


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400015184

Click here to view details at Spud DB Genome Browser (opens in new window)