All Microarray Probes on Gene DMG400010674

Probe IDChip nameTranscript IDProbe Sequence
CUST_23992_PI426222305 JHI_St_60k_v1 DMT400027692 GAGATTATGGTGTTAGATGAATTTTTAGACTGTTTTGGACTTGGACATCGATTAGATGTC


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400010674

Click here to view details at Spud DB Genome Browser (opens in new window)