All Microarray Probes on Gene DMG400009876

Probe IDChip nameTranscript IDProbe Sequence
CUST_7711_PI426222305 JHI_St_60k_v1 DMT400025558 GTGTTTAATACTACTATTTCTCCTCCACCAAGCAGCTTGCCTTTGCCCACTTTTTCATTG
CUST_7647_PI426222305 JHI_St_60k_v1 DMT400025559 CTCCGGCGACTACTTAGACTTAGATGAAGTGTTAAATGTTAAATTGCGCATTAATTAGAT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400009876

Click here to view details at Spud DB Genome Browser (opens in new window)