All Microarray Probes on Gene DMG400007010

Probe IDChip nameTranscript IDProbe Sequence
CUST_13664_PI426222305 JHI_St_60k_v1 DMT400018046 CATGTTATGTTGCTTCACTCTTCAAAAATATCGACAGTTGCATCTCAGATCTTTCAAAAG


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400007010

Click here to view details at Spud DB Genome Browser (opens in new window)