All Microarray Probes on Gene DMG400003518

Probe IDChip nameTranscript IDProbe Sequence
CUST_5415_PI426222305 JHI_St_60k_v1 DMT400009051 CGGAACTTAACAATTTGGAGCTGATGAGCATGATATTCAACTGTAATGAAGTGTGTAAAT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400003518

Click here to view details at Spud DB Genome Browser (opens in new window)