All Microarray Probes on Gene DMG400001508

Probe IDChip nameTranscript IDProbe Sequence
CUST_5040_PI426222305 JHI_St_60k_v1 DMT400003805 CATGAAGAAGATTCGAAATTAGGAATGCAAATGAGGAGAATTGAACCAACAAGCTCAACT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400001508

Click here to view details at Spud DB Genome Browser (opens in new window)