All Microarray Probes on Gene DMG400000570

Probe IDChip nameTranscript IDProbe Sequence
CUST_17569_PI426222305 JHI_St_60k_v1 DMT400001535 TGTTTTCCTCTGAATCTCTGGTGGCAAACAATGACAATAAATTTCAACTTAGTAGTGAAG


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400000570

Click here to view details at Spud DB Genome Browser (opens in new window)