All Microarray Probes on Gene DMG400000151

Probe IDChip nameTranscript IDProbe Sequence
CUST_2920_PI426222305 JHI_St_60k_v1 DMT400000443 GAACTCGGCTTGAAAGTTCCTCCAAAGAGAACAGGCTTTTCTTCTGGAAAATGGATCTAA
CUST_2810_PI426222305 JHI_St_60k_v1 DMT400000444 CTAGGTGGCTTTATTCAACTTTATTTATTTGGAGAAAGGACTAATCAACCATTGTTGGTC
CUST_3122_PI426222305 JHI_St_60k_v1 DMT400000446 CTAGGTGGCTTTATTCAACTTTATTTATTTGGAGAAAGGACTAATCAACCATTGTTGGTC


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400000151

Click here to view details at Spud DB Genome Browser (opens in new window)