All Microarray Probes on Gene DMG400000149

Probe IDChip nameTranscript IDProbe Sequence
CUST_2918_PI426222305 JHI_St_60k_v1 DMT400000439 CACAACTCTGTGACAAGAAAGTGGATGATAATGTTTCATCATGTTCTTGATTTTGTCTTG
CUST_3164_PI426222305 JHI_St_60k_v1 DMT400000440 GATTTCGTCTTAAAAGTAAGGAATGACTTCATATTAGTGAGATGTTGCACTCAGAATTCC
CUST_2999_PI426222305 JHI_St_60k_v1 DMT400000436 CACAACTCTGTGACAAGAAAGTGGATGATAATGTTTCATCATGTTCTTGATTTTGTCTTG


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400000149

Click here to view details at Spud DB Genome Browser (opens in new window)