All Microarray Probes on Gene DMG400000072

Probe IDChip nameTranscript IDProbe Sequence
CUST_3267_PI426222305 JHI_St_60k_v1 DMT400000230 CTGATCGAGATAAGTAAGAAATCAGCATGTGATAAAGACACCCAAGCAGGTTATATTTTG
CUST_3237_PI426222305 JHI_St_60k_v1 DMT400000232 CTGATCGAGATAAGTAAGAAATCAGCATGTGATAAAGACACCCAAGCAGGTTATATTTTG
CUST_3082_PI426222305 JHI_St_60k_v1 DMT400000231 GGTGGAGGCAAACGTATGGTTCTATTATCTGTTTCTCTACTTACTTGAGCTTTTCTATGT


Link to Spud DB Genome Browser for Transcript PGSC0003DMG400000072

Click here to view details at Spud DB Genome Browser (opens in new window)