Microarray Probes on PGSC0003DMT400097397

Probe IDChipProbe Sequence
CUST_1216_PI426222305 JHI_St_60k_v1 GAGGCTGATGATTATGATCTCAAGAATTTTTGTTTTGATTCCAAGCGTAAACACTCTTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400097397

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400097397 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g088170.1 +1 0.0 1053 520/540 (96%) evidence_code:10F0H1E1IEG genomic_reference:SL2.50ch02 gene_region:44903957-44905576 transcript_region:SL2.50ch02:44903957..44905576- go_terms:GO:0034046 functional_description:Pentatricopeptide repeat-containing protein (AHRD V1 ***- D7M7B4_ARALY); contains Interpro domain(s) IPR002885 Pentatricopeptide repeat
TAIR PP10 AT5G15300.1 +1 0.0 625 294/528 (56%) Pentatricopeptide repeat (PPR) superfamily protein | chr5:4968384-4970030 REVERSE LENGTH=548

Transcript Sequence (1620 bp)

>PGSC0003DMT400097397 1620 pgsc_dm_v3.4
ATGATCAAAAAGACAATAGCAAGCAGGAGTTCAAATCTTCACCGACAATCATCACTATGG
AGCAAATGCAAAGATGTCCAATCCCTAAAGCAAATTCATGCTTTGATGATCATCAATGGC
TTCAACTCCAATCGCATTGCTCTCAGGGAGCTCATACATGCTTCTGCTGTTACTTTCTCA
GCATCTATTCACTATGCCCACAAGCTGTTTGCTCAAATTACTCAACCAGATCTCTTCATG
TGGAACACCATGCTTAGAGGGTCAGCTCAGAGTCACAGGCCTTCTCTTGCTGTTTCCGTT
TATACCCAGATGGAAAAACGTTCCATACTTCCGGATAGTTATACTTTTCCGTTTCTACTC
AAAGCATGTACCAAGCTTTCTTGGCTTGTTTCTGGCCTTACCGTACATGGGAAAATTGTG
AAACATGGGTTTGAATCTAATAAATTTGCGAGGAATACCCTTATATATTTTCACGCTAAT
GTTGGAGATATAAGAATTGCAGGCCAACTTTTTGATGGTTCTGCTAAGAGGGACGTTGTT
GCTTGGTCTGCTTTGACTGCTGGATATGCGAGGAGAGGGGAATTGGATGCGGCAAGGAGG
CTTTTTGATGATATGCCGGTTAAAGACTTGGTTTCTTGGAATGTAATGATCACTGGGTAT
GTGAAGCAAGGGAAGATGGAGAATGCGAGGGAGATGTTTGATATTGTGCCAAAGAGGGAT
GTTGTGACTTGGAATGCCATGATTTCTGGATATGTGCTTTGTGGAGAAAATGAGAAGGCT
TTGAAAATGTACGAAGAGATGAGAGGTGCAGGGGAATACCCTGATGAAGTCACTATGTTG
CACCTTTTATCCGCTTGCACGGATTCAGCATTCTTGGATGTTGGCGAGCAGATACATCGA
TCAATTATTGAGATGGGTGCAGGCGAGTTAAGCGTATTTCTTGGTAATGCACTTGTAGAC
ATGTATGCTAGGTGTGGCAGCATTAGTAAGGCACTTGAAGTGTTTCAAGGCATGAGAGAG
AAGGACGTGTCGTCTTGGAACATAATTATATTAGGATTAGCTTTCCATGGTCATTCTGAA
GAATGTATCTCTCTTTTTGAAGATATGAGGAGAATGAAGTATATCCCTAATGAAATTACT
TTTGTTGGTGTATTGGTTGCTTGTAGTCACGCTGGTAAAGTTGATTATGGCCAAGAATAT
TTCAACATGATGAGAACTGACTACAATATTGAGACAAACATAAGGCACTATGGTTGTATG
GTGGATATGCTAGCACGTGCAGGACTATTGAATGAAGCGTTTGAATTCATAAACACGATG
GAGATTAAACCTAATGCTATTATATGGAGAACACTGCTAGGAGCTTGTAAAGTTCATTCC
AATGTCGAGCTGGGAAGGTATGCTAATGAGCAGTTGCTTAAATTGGGAAGGGAAGACAGT
GGGGACTATGTCTTACTGTCTAATATCTATGCGTCAAGGGATGAATGGGATGGTGTTGAA
AGGGTGAGGAAGTTGATGGATGACAATGGGGTTTGGAAAGAACCTGGTTGTACTTTAATT
GAGGCTGATGATTATGATCTCAAGAATTTTTGTTTTGATTCCAAGCGTAAACACTCTTGA