Microarray Probes on PGSC0003DMT400097105

Probe IDChipProbe Sequence
CUST_35286_PI426222305 JHI_St_60k_v1 AGTTACTTTAGGCATTAGTGGTTTAGTTTCTGCATGGGCTGGTTGGTATAGAAACTGGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400097105

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400097105 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47430.1 +1 8e-107 311 166/224 (74%) peroxin 11B | chr3:17480798-17481692 FORWARD LENGTH=227

Transcript Sequence (678 bp)

>PGSC0003DMT400097105 678 pgsc_dm_v3.4
ATGAATGACACAGTGGACAAGCTGGTAATTTTCTTAGCAAAGAGAGATGGAATCGACAAG
CTTGTCAAGACTTTCCAGTACGTCTCCAAGCTCGTAAATTGGCACGTCGAGACGACGTAC
CCTGACATAGCCACTCGAGCCAAGCAATGGGAAGTGGCCTCTGGCCTCAGCCGAAAAGCC
TTTAGGACAGGTCGATCCCTCACAGGATTCAACGCTCTCCGAAGAAGCCCGGGGACTTCC
CCAGGTTTCAGGTTGCTAGCAGTTCTCGCCAATTCAGGGGAAATGGTTTATTTCTTCTTC
GACCATTTCCTCTGGCTGGCGAGAATTGGAGTAATCGACCCCAAATATGCAAAAAGGATG
AGCTTTATTTCTGCATTTGGTGAGTCTGTTGGATACGTGTTTTTCGTTATTTCGGATTTT
ATTCTCATTACAAGGGGATTAAAAGCAGAGAGGAGGTTATTGATTGAAGAGAAGGATTCT
AAAGAAACAGAAGGGGAAATTAAGAAAATTAGAATGGATAGAATAATGAGATTGATGGGT
GTGGCTGCTAATATTGCTGACCTTATAATAGCCATAGCTGAAATTGAACCAAATCCATTC
TGCAACCATACAGTTACTTTAGGCATTAGTGGTTTAGTTTCTGCATGGGCTGGTTGGTAT
AGAAACTGGCCCTCCTGA