Microarray Probes on PGSC0003DMT400095861

Probe IDChipProbe Sequence
CUST_30964_PI426222305 JHI_St_60k_v1 ACCTCATCTGGCTTGATCACTCCAGTTTTTATAGAGGATCAATTCATTAATGTATGGTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400095861

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400095861 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G10560.1 +1 4e-139 423 235/553 (42%) plant U-box 18 | chr1:3484613-3486706 FORWARD LENGTH=697

Transcript Sequence (1683 bp)

>PGSC0003DMT400095861 1683 pgsc_dm_v3.4
ATGCTGGCAAGAGCTGTTGCTGTGGCACTTGATGTTCTTCCTTTGAAGGAAATGGATGTT
TCTGTGGAGGGTCAAGAAGTGGTTGAGTTTGTGAGGAATCAAGCTGTTAAGTTGAAGTTT
GAAGTGGAAATGGATGATGGGAGAATGCAAGTGAATGTTTTGAAGATTTTGGATCAACTT
GAAAATGAAGTTATTCCAGAAACGCGTGATCTGAAAAGGGTTCTTGATTCTTTAGGGATT
ACACGTTGGAGCGCGTGTAATAGAGAAGTTAAGTTCTTGGATAATGAGATGTTGTTGGAG
GGGAATACTGAGGAGAAGAGAGATATGGGAATCCTTAGTAGCTTAATGGGGTTCATGATA
TACTGCAGGGGAACTCTGTTTGAAGTATTGGATAATGGAGCAGGCAGACAAATCAATGGA
GGCAGTACTAATGCAGATCAAGTCATCAGGTTCTTGAATCTTGATGATTTCAGGTGTCCA
ATTACACTTGAAATCATGAGTGAGCCAGTGACAATAGCCTCAGGTCACACATATGATCGG
GCTTCGATTCTGAAATGGTTCAGAGCTGGAAACTCCACTTGTCCAAAGACTGGTGAGAGG
TTAACAAGTATTGATTTGGTTCCTAATTTTGCTTTGAAGGTTTTAATCAAGCAGTATTGC
TCCGCGAATGGTATTCCATTTGTGGAGACTGGTAGGCGAAATCGTGATGCTGGAAGATTT
GTTGGTTCAAGCAGTGTGGCTAATGAGCAGGCTATGAAGTTGCTTGCAAGTTTTCTAGTA
GGCAGGCTGGTTGGTGGAACAATGGAACAGCAAAATAAGGCTGCTTTCGAGATTCGTTTG
CTCACTAAAACAAGCATTTTTAACAGGTCTTGTTTGGTGGAAGCTGGTGTAATCCCACCT
CTTCTGAATCTTGTTACTTCAAGGGATTCTTCTTGTCAAGAGAATTCAATGGCTACTCTG
CTGAACCTCTCAAAGAACTCTAAATGCAAAAGCACAATTGTTGGAAATGGAGGTTTGTTC
TTGATACTTGATGTGTTGAAAGGAGGGCTAAAGATGGAAGCTCGACAGCACGCAGCTGGT
ACATTATTCTACCTTACATCAGTAGAAGAGTACCGTAAAATGATGGGAGAAAATCCAGAG
TTCATTCCATCACTTTTGGAGTTGCTAAGAAATGGCACTGACAGAGGAAAAAAGAATGCC
TTGGTCACCATTTTTGGCCTCCTAATGCGCCCCGAAAACCACTGGAGAGTGATTGCTGCT
GGATTAGTCCCCTTGGTGGTTAATCTGTTGAAATCTTTCGAAAGGGAAGATCTCATTACA
GATTCTTTAGCAGTTTTAACAACGCTTTCTGAAAGGCTAGACGGAGCAATGGCTGTTCTT
TATGCTGGAGCTTTGCCTATTATTGTCAATGTTCTAAGTTCTTGCAATTCAAGGGCATCA
AAAGAGTACTGTGTCTCATTGTTGCTGGCTTTGTGTATCAATGGTGGAGCAGATGCAGTT
CCTGTTTTAGTAAAGAACTCATCTCTCATGGGACCGTTATATTCCCTCCTGGCTGAAGGC
AACTCAAAAGCAAGCAAGAAAGCTAGTACACTCATCAGAATCTTGCACGAGTACAACGAG
AAGACCTCATCTGGCTTGATCACTCCAGTTTTTATAGAGGATCAATTCATTAATGTATGG
TAA