Microarray Probes on PGSC0003DMT400093792

Probe IDChipProbe Sequence
CUST_51683_PI426222305 JHI_St_60k_v1 AAGAGGATGAAGAGATAGATGGCGTGGCGGAAGAACTGGTGGCACTTTGTAGCAATAAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400093792

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400093792 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G65550.1 +1 2e-47 164 84/204 (41%) UDP-Glycosyltransferase superfamily protein | chr5:26198410-26199810 REVERSE LENGTH=466

Transcript Sequence (627 bp)

>PGSC0003DMT400093792 627 pgsc_dm_v3.4
ATGGATCAAGATGATTATGAGGAAATCGCGCAATGGCTTGACAAGAAAGAGAAAAGTTCA
ACTGTGTTCGTTTCATTTGGGAGCGAGTATTTTCTATCCAAGGAGGAAATACTTGCAGTA
GCTCAAGGGCTAGAGCTTAGCAAAGTGAACTTCATTTGGGTCATCAGGTTTCCACAAGGT
GAAAGACTTAACATTCGAGATGCATTACCGGAAGGGTATCTTGAAAGGGTAGGAGAAAGA
GGAATGATTATGGAAGGATGGGCTCCACAAGCATTGATTCTTCAACATCCATCGATAGGT
GGATTCGTGAGTCACTGTGGATGGAGTTCATTCATGGAAAGTATGAAGTTTGGTGTGCCT
ATAATTGCCATGCCAATGCACATTGATCAACCAATGAATGCTAGGCTTGTGGAATATATC
GGTGTGGGAGTGGAAGCAGCGAAGGACGAGGATGGGAAGTTACAAAGCGAAGAGATTGCA
AAGGCAATAAGGGAAGTGTTAGTGGAGGAAAGCGGGGAGGCTGTGAGGAAGAAAGCTAAG
GAACTGAGTGAGAAGATGAACGCGAAAGAGGATGAAGAGATAGATGGCGTGGCGGAAGAA
CTGGTGGCACTTTGTAGCAATAAATGA