Microarray Probes on PGSC0003DMT400091565

Probe IDChipProbe Sequence
CUST_44696_PI426222305 JHI_St_60k_v1 AAAGAGCCGGTGATGTACTGCAACGATTGCAAACTCTTCTTCCCTCAATCTCTAACTCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400091565

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400091565 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G44414.1 +1 6e-54 167 75/107 (70%) unknown protein; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:16847781-16848086 FORWARD LENGTH=101

Transcript Sequence (324 bp)

>PGSC0003DMT400091565 324 pgsc_dm_v3.4
ATGTTCTTCTTCTTCGTAGGAGGCTTAGAGCAGCAGGCGAGACAGGTATTGAAGAGCGGG
GCAGGGAGGTGCATTGCGTGCGGATCACGCGCCGACCTCGTCGGTTATGAAAAGGTTCTC
AAGCTCTTCTTTGTTCCGGTGTGGAGATGGCCGGGAAAAGAGCCGGTGATGTACTGCAAC
GATTGCAAACTCTTCTTCCCTCAATCTCTAACTCCTCCGCCGTCATCCACGGCTGAGGTC
CCGGACGTTCTTAGGTGTCAGTTCTGTCGCCGGGAAGTGGACGGCGATTTCCGATTCTGT
CCCTTCTGTGGTAATGCACTGTGA