Microarray Probes on PGSC0003DMT400091423

Probe IDChipProbe Sequence
CUST_12957_PI426222305 JHI_St_60k_v1 GGTCCAAGAAAGGCAAATTCTCAAATTCTTCAGAAATAAATATTGGTGGACCTTCTGTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400091423

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400091423 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G40250.1 +1 1e-90 278 170/319 (53%) RING/U-box superfamily protein | chr5:16086056-16087186 FORWARD LENGTH=376

Transcript Sequence (939 bp)

>PGSC0003DMT400091423 939 pgsc_dm_v3.4
ATGAGCAGAATCAGTCCAATTGTCCTATGGGCAATTGTAATTATTGCTATTGTGTTCTTT
GTGTTTGGTCTTCTTCATCTTCTTCGTAGGTGTTGTTTAAAGATTTCATCTTTTTCGTCA
ATTTCTCAATCCAATAGATTCCCTGAATCATCTGGTTCTCAAGTTATTCAAAGGCAACTT
CAACAGCTATTTCGTCAGCATGATTCTGGTTTAGACCAAGCTGTCATTGATACTCTGCCT
CTGTTTCTCTATAAAGATATTAAAGGCCTAAAGGAGCCATTTGATTGTGCTGTTTGTTTA
TGTGAATTTTCAGAACATGATAAGCTCAGATTGCTCCCTTTTTGTAGCCATGCTTTTCAT
ATTCATTGTATAGACACATGGTTACTGTCAAACTCAACTTGTCCTCTATGTAGAGGCATT
ATTAGTTCCACAGTTTCTATGGGAAATCCCTTATTGGGCTCAATCGAATCAAGAGAACAA
TGGAGTTTCCATTTGGAAGATGGAATTGCAAATGATGAAAAGCCGGACAATGTTGGAGAA
ATGAGAGTATTTTCTGTTCGATTAGGTAAATTGAAGAGTCTAAATGAAGGGGGCGAAAAC
CATGAAGACAAAAGTACTCAAGGGGAAATCATCAGCTGTAATTTAGATGCAAGGAGATGT
TTCTCCATGGGTTCATTTCAATATGTTGTTGGTGATTCGGAGTTACAAATCGCGTTGCCT
AATGTGAAGATTCTAAAAGCCAAGTGTGAGAACACTATTTTTGGGGCTAATGCAGAAGGA
AAAAAGATCAGTGCTAGGACTAAAGGTGAGAGCTTTTCTGTTTCAAAGATTTGGCTTTGG
TCCAAGAAAGGCAAATTCTCAAATTCTTCAGAAATAAATATTGGTGGACCTTCTGTTAAT
ATTGATATACCAATGACTAAAACAACACAATTTGTGTAA