Microarray Probes on PGSC0003DMT400089913

Probe IDChipProbe Sequence
CUST_13131_PI426222305 JHI_St_60k_v1 CCCATTATCACTACACATAGGGGATCCATTCGAAGGGTTTCCAATTGCTAACCCTTCATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400089913

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400089913 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G59720.1 +1 1e-51 165 109/160 (68%) heat shock protein 18.2 | chr5:24062632-24063117 FORWARD LENGTH=161

Transcript Sequence (462 bp)

>PGSC0003DMT400089913 462 pgsc_dm_v3.4
ATGTCTCTGATTCCAACTTTCTTTGGTCGGAGCAATATCGTCGACCCATTATCACTACAC
ATAGGGGATCCATTCGAAGGGTTTCCAATTGCTAACCCTTCATCCTCTGTTCGTGAAACC
TCTGTTTTCGCAAATGCAAGAATCGATTGGAAAGAAACCCCGGAAGCTCATGTTTTTAAA
GTGGATGTACCTGGGATTAAGAAAGAGGAAGTGAAAGTTGAAGTTGAAGAAGGAAGGATT
TTGCAGATTAGTGGTGAGAGGAGTAAAGAGCAAGAGGAGAAGAATGATCAGTGGCACTGT
ATGGAGAGGAGTAGTGGTAAGTTTATAAGGAGGTTTAAGTTGCCGGAGAATGTGAAAATG
GAGGAAATTAAGGCGGCGATGGAGAATGGTGTGCTTACTGTAACTGTTCCTAAAGAAGAA
GAGAAGAAGCCTGAGGTGAAAGCTATTAATATCTCTGGTTGA