Microarray Probes on PGSC0003DMT400089070

Probe IDChipProbe Sequence
CUST_61_PI426222305 JHI_St_60k_v1 GATGCAATCAAGGAATTGAATATACAGGGCTGTCCAAAATCAATGAGAGTTGTAATTTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400089070

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400089070 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc01g057010.1 +1 1e-93 289 163/379 (43%) evidence_code:10F0H1E0IEG genomic_reference:SL2.50ch01 gene_region:50833554-50834726 transcript_region:SL2.50ch01:50833554..50834726+ functional_description:F-box family protein (AHRD V1 ***- B9GFB6_POPTR); contains Interpro domain(s) IPR017451 F-box associated type 1
TAIR PP10 AT4G12560.1 +1 2e-28 114 104/379 (27%) F-box and associated interaction domains-containing protein | chr4:7441815-7443157 FORWARD LENGTH=413

Transcript Sequence (1125 bp)

>PGSC0003DMT400089070 1125 pgsc_dm_v3.4
ATGAAGAAATATCCTGAAGATATGCTCATTCATATCCTTTTGAGACTTCCACTGAAATTT
ATCTTGCGATTCAAAAGTGTCTCCAAAACTCTTTACACTCTCATACAATCTTCATCTTTC
ATCAATATTCATTACAACCACACATTAAATTCGACATATGATAACATTCTCCTAAAGCGC
TCCTTCAAAGAAGACATTGAAAGATATAAAGCTGTTTTTTCTTTTATTCCTAATGACGAT
GAAGATAATTTAAATACCGTTTATCCAGATCTAGATGTTCCTTATACGTCAAGTATTTCT
AGTGTTAAAAGTGATAAGCTCATCAATTCTAGCCATGGTTTAATTGCTTTGATGGAACCA
CGAACCACCATCGTGTTCAATACATCAACTAGAAATTATAAACGACTCCCTCCTAGCCAT
TTTCAAATTTCGAAGGGAGAATATCAATCGTTTGAAAGTGGTGGATTTGGTTACGATTCA
GTTGTTAATGATTTCAAGGTTTTTAGAATATCTGAAGTTTTCAAGGAAGATGGTTTCGGA
CACATTAACGATGGAGAGAAAAGGGTTGAGGTATATGAATTGGGTATTGATATTTGGAGA
AAATTGGATCATGTGGATCAACAATTGCCCAAATTATTTTGGTTGAATTCTTCAATGTCT
TATAAGGGTTGTTACCATTGGATTGCATCATTTGAAGGACAAAAAATCATTCTTTGCTTT
GACATGACAACCGAAATTTTCCGAAATATACAAATGCCAGCAGACACAAGCAAATTTACA
GAGGGCACACTTCATAGCCTCCTAATTTTGAATGAGTCTCTAAGTTTGTTATGTTACCCT
TCAGTTATTGATCCAAATACAGATTTTATGGAAATTTGGATTATGAAGGATTACAATATT
TATGAGTCTTGGATTAAGAAGTACACAATAATTGGTGTTCCTACTGAAAACCCATTAGTA
ATGTGGAAAGATTTTGTATTGCTTTTTCAAAGCAAAAGTGGATATTTGATGTCATATGAT
CTTAAACATGATGCAATCAAGGAATTGAATATACAGGGCTGTCCAAAATCAATGAGAGTT
GTAATTTACAAAGAATTCTTGACTCCCATTCAAAGAGAAAGCTAA