Microarray Probes on PGSC0003DMT400086922

Probe IDChipProbe Sequence
CUST_22223_PI426222305 JHI_St_60k_v1 CTGAATTCAGCAATTTTGATGATTTAGGAATGGATGATTTTTCCCAAGACAGTGTTGTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400086922

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400086922 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G27950.1 +1 1e-58 197 146/373 (39%) cytokinin response factor 4 | chr4:13909732-13910739 REVERSE LENGTH=335

Transcript Sequence (1170 bp)

>PGSC0003DMT400086922 1170 pgsc_dm_v3.4
ATGGATCATCATTTGTTGTGTCCGATCAAATACACCGAGCACCGGAATGTTATCAGGAAA
GTTACTAAACCATCTTTGGTGAAATCAAAAAAATTCCCAGAAGCCACAAAATCCTCTCAG
TTCAATCCCTCTGTTCCGAGGACTGTTCGGATTTCTGTGACAGACCCAGACGCAACGGAT
TCTTCTAGTGATGAAGAAGACATGCTTTTTGGACGGCGACGGGTGAAAAAATACATCAAT
GAAATCAGTATTGAAACCGCCGTCAAGTGTGAAGTTAGCATTCCTAACAGTGGCAATGGC
AAAACGGTGAATAAAAGAGCACCGGAGCCTCTTCAGACTAAGCAGAAGCCAATGAAAGTT
CAACCTCCTCAATCGGCTGGCGCTGTTAGGAAGTTCCGCGGTGTGCGTCAACGGCCGTGG
GGCAAATGGGCCGCTGAGATCAGAGACCCGGCTCGCCGTGTTCGGCTTTGGTTGGGAACT
TACGACACTGCTGAAGAAGCTGCTATGGTTTATGACAACGCTGCTATTAAGCTTCGTGGG
CCAGATGCTTTAACAAACTTCAGCACTCCTCCCAAGCCGGAGCCAGAACCAGAGCCAGAG
CCGGAAATCAGTGTTCTATCTCACTCCGGCTATGAATCCGGGAATGAGTCCCGTAACATC
CCTTCTCCGACTTCTGTTTTGCGGTTTAGAATGAGCCAGTCAGAAAGTGGGTCTGACCCG
ATCCATGTTTCGGAAGAGTGTCCATCGATTCAAGGATCGATGGAATGTGAGCAAACGGTT
CAACCGTTTGTTCAATGTGCTGCTGAACCGCAGTTGGTTCAGCAGGATGTTGAGGAGTGT
CAGGGCGAGACCAGCATGATTCCTGATTACTCAAACGATTACTTGCCAACAGATATTCCA
TTCTTAAATGATTTTTTCAATTTCGATGGTTCAGCAGCTGAACAGACGTTATTTGAGGAC
TCAACTATAACATCAACAACAACAACGACACCAAATTGTCCCAATGATTTTGGCTCATTG
TACAACGATTCATTGGATTTCGGGAATGATTTCTTGTTTAACGATGCTGACTTCGCTGAA
TTCAGCAATTTTGATGATTTAGGAATGGATGATTTTTCCCAAGACAGTGTTGTTGATTAT
TCCAGTGTTGATTCTCTGTTGGCGATTTGA