Microarray Probes on PGSC0003DMT400086334

Probe IDChipProbe Sequence
CUST_13091_PI426222305 JHI_St_60k_v1 GTGAATTTTGATGAGTTCAAGAAGATGATGAAAGCTTGTGGAACTCTTGTTCCATTTTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400086334

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400086334 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G07490.1 +1 2e-40 137 80/158 (51%) ARF-GAP domain 11 | chr3:2391189-2391650 FORWARD LENGTH=153

Transcript Sequence (534 bp)

>PGSC0003DMT400086334 534 pgsc_dm_v3.4
ATGGCTGATCAAAAGAAGGTAAAAAGCTTTAACAATTACAACAAGGTTGAACTAAGGGGT
ATTTTTTCAACTTTTGACAAGAACAATGATGGTTACATAACAAAGCAAGAATTGAAGCTA
TCTCTCAAGAATATTGGGATTTTTATGGAGGATAAAGATATTGTTGATATGGTTGAGAAG
GTTGATTCAAACAAAGATGGTTTAATTGATCTTGATGAGTTTTATGAACTTTGTCATACT
TTCTTGGGAATAGAGGGAGTGGAACAAGAAGGTGAAATGAATGAAGAAGAAGTGGCTAAT
AGAGAGCAAGGTCTTAAGGAAGCTTTTGATGTATTTGATCATGATAAAGATGGATTAATA
TCAGAAGAAGAATTGAGTAAGATTCTTTCATCTTTAGGAATGAAAGAGGGTAAGAAATTG
GATCATTGTAAAGAAATGATAAAGAAAGTTGATGTGGATGGAGATGGAATGGTGAATTTT
GATGAGTTCAAGAAGATGATGAAAGCTTGTGGAACTCTTGTTCCATTTTCATAA