Microarray Probes on PGSC0003DMT400086307

Probe IDChipProbe Sequence
CUST_52089_PI426222305 JHI_St_60k_v1 GTGCATCTTTGTGGAGAAAGAAAAGGATAAGGGTATTTATTGGTACAAGAACAAGATTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400086307

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400086307 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G12120.1 +1 0.0 524 240/383 (63%) fatty acid desaturase 2 | chr3:3860592-3861743 REVERSE LENGTH=383

Transcript Sequence (1134 bp)

>PGSC0003DMT400086307 1134 pgsc_dm_v3.4
ATGGGAGGTGGTGGTAATATGAGCAGTAAAATAGACGAAAAGAAAAATGTTGCAAAAAGA
GTTCCATCTTCAAAGCCGCCTTTTACAATTGGTGACATAAAGAGGGCAATCCCTCCCCAC
TGCTTTGAACGATCTCTTATTAAGTCGTTCTCGTATCTTATTCAGGATCTCATACTTGTC
TCCATCTTTTACTACATTGCCAACACTTACTTTCACCTCATTCCATCCCCATATAGTTAT
GTAGCATGGACTACTTACTGGATTGCTCAAGGTTGTGTTGGGGAAGGAATATGGATCCTT
GCTCATGAATGTGGACACCATGGCTTCAGTGATTACCAATGGGTAGATGACACCGTTGGT
CTTATCCTCCACTCTGCACTTTTAACACCATACTTTGCATGGAAACATAGTCATCGTCGT
CACCATTCCAACACTGCTTCCATTGAGAATGATGAAGTCTACAAACCAAGAATTAAATCT
AAACTAAGATGGTACTACAATTACTTGAATAATCCACTAGGAAGACTACTCATACTTGCC
TTCACCCTTACTTTTGCATGGCCTTTGTACTTGCTCTTCAATGTCTCAGGAAAAAATTAT
GACCGTTTTGCAAGTCACTATTATCCATATAGCCCAATATATAGTGATCGTGAGAGGCTA
CAAATCTACATTTCAGATGCAGGTGTCATTGCAACAACTTATTTGTTGTATCGCGCTATT
ATGATAAAAGGGCTAGCTTGGGTTTTTTGCATCTATGGGGTACCCCTCCTTATTGTGAAT
GGGCTTGTAGTGTTTATCACTCTTTTGCACCACACACACTCTTCATTGCCACATTATGAT
TCAACTGAGTGGGATTTTCTAAGGGGAGCTTTAGCTACAGTAGATAGAGACTATGGTTTC
TTAAATAAGGTGTTTCACAACGTTACAGATACACATGTTTTGCATCATATATTTCCATAC
ATATCACATCACCATGCAGTTGAGGCAACAAAAGCTATCAAACCATTGTTGGGAGAATAC
TATAAATTTGATGATACACCAATTTTAAAGGCAATGTGGAGGGATATAAATGAGTGCATC
TTTGTGGAGAAAGAAAAGGATAAGGGTATTTATTGGTACAAGAACAAGATTTGA