Microarray Probes on PGSC0003DMT400085818

Probe IDChipProbe Sequence
CUST_41464_PI426222305 JHI_St_60k_v1 ATGAAAAGACGGAGACATTGTTGCATGAATCCAAAAGCAGGCTGGAACTCTACCAGTCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400085818

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400085818 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G66200.1 +1 0.0 740 433/649 (67%) armadillo repeat only 2 | chr5:26453648-26455603 REVERSE LENGTH=651

Transcript Sequence (1896 bp)

>PGSC0003DMT400085818 1896 pgsc_dm_v3.4
ATGGCGGATATAGTTAAGCAAATCTTGGCAAATCCAATTCAATTAGCTGATCAGGTGATC
CAGGCAGCTGATGAGGCTGTTTTATTCAGTCAAGAATGTGCTGAGCTCAAGTCCAAGACT
GAGAAGCTGATTGTGCTGCTTCGTCAAGCAGCACGAGCCAGCAACGAGCTCTATCAACGA
CCCATGAGCCGAATTATTGATGATACTGAACAAACTTTGGAAAGAGCTATGTCTATTGTT
ACCAAATGCTGCACTCAGGGACTAGTGAAGCGCGTATTTACCATCATACCTTCTGCAGAT
TTCCGTAACTTGTCTTCACAGTTAGAGAATTCTATTAGTAATGTGTCGTGGCTACTCCGC
GTCTCTGCCTCAGCTGAAGAGGGTGCTGATAGGTACTTAGGACTTCCTCCTATTGTTACT
AATGAGCCTATATTGTGTTTTATTTGGGAGCATATAGCCATTTTGTGTACTGGTTCGGTT
AATGATCGATCTGATGCTGCTGCATCATTGGTTTCATTGGCTAGAGATAATGATCGGAAC
AGAAAATTGATCATTGAAGAAGGTGGAGTAGGACCATTGTTGAAATTGTTGAAGGAAGGG
AAATTGGAGGGTCAGGAGAATGCTGCAAAGGCAATTGGATTACTAGGATGTGACCCTGAA
AGTGTCGAACACATGGTGAATGCTGGGGTGTGTTTGGTTTTTGTGAAAATCCTCAAAGAA
GGTCTAATGAAAGTTCAAGCAGTGGTGGCTTGGGCAGTTTCTGAACTTGCTGCACATTAC
CCCGAATGTCAAGATGTTTTTCATCAGAATAACATAATCAGATTACTTGTTAGCCATCTC
GCGTTTGAGACGGTTCAGGAGCATAGCAAGTATGCTATTGTTAGCAAATCCACGTCGATT
GATGCTGTTCTTTCAGCTAGTAATGTGAGTAGTGTGCACAAGGTGAATGAGGATGATGAT
AATAGCCACATTCCACATCCTTTAGGAAATAAGAAGCCTACTCAGATGCACACTGTGGTT
ACTGCCACCACGGCTATGCAAGCGTCTCAGCAGATTCCGGTCAATGATGCAAAACAGACA
TATCATCAGCAGAGTCATTATGCTACAGGGGTCAGTAATAAAGGGCGAGAATCGGAGGAC
CCTAATACCAAGGCTTATATGAAGGCAATGGCTGCAAGAGCTTTATGGAAACTGGCCAAG
GGAAATTCAACTATTTGCCATAGCATTACTGATTCAAGAGCACTGCTTTGCTTTGCAGTA
CTCTTGGAGAAAGGGGATAAAGATGTTCAGTATCATTCGGCGATGGCAGTAATGGAAATC
ACAGCTGTAGCGGAGAAAGATCCTGATTTGAGAAAGTCAGTGTTCAAGCCTAATTCACCT
GCTTGCAAAGCTGTTGTTGATCAACTGTTGAGAATCATTAAGAAAGAAGATTTGAACCTG
CTTGTTCCATGCATTCGATCAATTGGGAATTTGGCCACGACTTTTCGAGCTACAGAGACG
AGGATGATTAGCCCATTAGTAACGCTGCTCGATCAACGAGAACCAGAGATTTCAAATGAA
GCAGCCATTTCCCTCAAGAAATTTTCTTGCAATGAGAACTACCTTCACCTGAATCATTGC
AAGGCAATAATAAGCGCTGGAGGTGCAGGACATTTGGTTCAACTTGTTTGCTTTGGTGAA
AAAGTAGTTCAGTTTTCTGCATTGCTTCTGCTATGTGACATTGCATTGCATGTCCCTAAT
AGCGAAGAGCTTGCTGAAGCCGAGGTGCTTTCAGTGCTCAAATGGGCATCAAAGCAGGCA
CACTTGAACCGAGATGAAAAGACGGAGACATTGTTGCATGAATCCAAAAGCAGGCTGGAA
CTCTACCAGTCCAGAGGATCCAGGGGATTCCATTGA