Microarray Probes on PGSC0003DMT400084734

Probe IDChipProbe Sequence
CUST_24984_PI426222305 JHI_St_60k_v1 ATTCCAAAAGCCCAAAGGTTATTGTAGCAGGTGTAGCACGCCGCTTTTGTCAACAGTGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400084734

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400084734 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G43270.2 +3 7e-60 209 163/432 (38%) squamosa promoter binding protein-like 2 | chr5:17360527-17362143 REVERSE LENGTH=419

Transcript Sequence (2149 bp)

>PGSC0003DMT400084734 2149 pgsc_dm_v3.4
AGGGAGAGTACTTTGTCATAATTTAGTTCATTTTGCTCTGAGCTGTTCAATTAGTCTGGA
AAAGAAGTTGGATTAGGAGAGATAATAATATCCTGCAAGTGAGAAAGAGAATTAGTTACA
GTTTTAGAGGTAGAACAGCAAATTTGTGAACCAGCCAAGCTCTACATCATTGGGTGAGCC
TTGATGGGATGGTCTCCTTTTCTTTTTTTCTTGTCCTGAATTTGTGTACTTGCACTTTGC
TTCTTGCTTCTTGCTTCCCTGTTGTCCGACAAAATGCTTGTTTTGCCTTTTGTGAAATTA
CGTACTTGTTAAACTAGGAATAAATATCAGTTAACTTTGAGTGTAAATATTTTGCAGATT
CAAGTCTTAATTACTGTTTTGCATTCCATGAGTCTGGAAATTTGGTAAAGCCATCTCATA
GTTTCTTTCCCAAGATGGAGTGGAATGTTAAGTGGGACTGGGGAAATCTCGTAATGTTTG
GTTCAAAGGCCTCTGAAAGTCCAAAAGAACTACAATTAACAGATTGGGGAGTTGAAGAAG
AGGGAGAACTTGATGGGGGATCTTTCAATTTGTCAAGTGGCGGTAGTGGCACGGGTGGTT
ATGGTTCTGATGTGAAGTGTGGTTCTTCCATCAAAAGCTCAATATCAGCTTCTACCGACT
CTTCACCAAAGGAGGGCTTTAAAGCATCCAACTTTGCTTTTGAGGCATTTAATACCTCTC
CTGAGGATCCTAGTAAGAAATTGGAATCCTCCAAAGCTGAGGTCTCTAGAAACTCACCAC
CCATGGAGGCTTCAGTAGGCTCTGTTGAACCAGTGATAGGTCTAAAACTTGGTAAGCGGA
CATGTGAAACCTTTGGTGGTGGAAGCAGTGCTAAGGTTTCATCCTTCCCTCCGAACCCCA
CATCATCTGCTGCAACAAAGAAAGCAAAATCATCTAGTCAGAATGCACCAATTCCTCACT
GTCAGGTTGAAGGTTGCAACCTTGATCTTTCTTCAGCTAAAGAATATTATCGGAAGCATA
GAGTTTGTGACAGTCATTCCAAAAGCCCAAAGGTTATTGTAGCAGGTGTAGCACGCCGCT
TTTGTCAACAGTGTAGCAGGTTCCATAGCGTGTCTGAATTTGATGAAAAGAAGCGAAGCT
GTCGTAGGAGGCTCTCTGATCACAATGCACGGCGCCGCAAACCTCACCAGGAAACTATCC
AGTTCAATTCAGCGAGGCTTTCTTCGTTGTTTTATGATAGCAGGCAACCCATGAATCTTG
TGCTCAACCAAGCACAACTCATTCACTCCAGAGCTGCTGCGAACTCTACCTGGGAGAGCA
CTCAAGACTCTAAGTTCAGTATCACAAGAGGGTTTACTCCAAAGCCTGAAAGAACTAGCA
GCACAAATGGGAAGTCACTACTGGAGGGGATCCAGTTTTCACGGGCTGTGGGTGCACAGA
GTAATGCATCTAGCTTGCTCTTGCCCTCCAAGGGCACCACAGCCGAGGTTTTTAATCGAG
GTGCCAAGGAATCCATGTTCAATATGGTTACAGGACCGGAATTTCCTCGTGCTCTCTCTC
TTCTGTCAACTAATTCCTGGGGTTCATCCGAGCCTGAGACTGTTTCACTCAACCATGCAA
ATCAAACCAGCATGCCCGAGCAGATGATGCAGGCAATTCCACAGGGTGTGCCGCATATGT
CCAGTCAATACTGGCAGCAGGCTGGACAACATTCATCCGATACTCGTTACCATACATTGG
CTGCTAATAGTAACAGTGGCGGTAGCTTTCAGGAAATGGGAGTGTTCAAAGCTCCATTCG
ACACAGACTTTTATCTCAATGCATTGAACTGAAGCCAACATCTGATGTGTTGGTGTATTT
TCAGGATTTGGCGACCTTTCCCATTTTGACATGTCAAAACTTGAAGGTCTCTGTTTAGTA
CTGGTATATAATATATAGGTTGGGCTTTTAAACTATTAAGAAAGTCTAATATTATGATGA
ATTATGCAGTAAAATTTTGTTTGCCAGTGACATGAATTCCCAAGAATTGTAATTTCTTGA
TTCTGCAACTTGGAACATAACTGCACAGGTTCCACCTATGAATGACTGTTTATCCTTTTT
CATCATGTTCAATTATTATATTATAACATTTACGTTATTATTAGTCTTC