Microarray Probes on PGSC0003DMT400084511

Probe IDChipProbe Sequence
CUST_51764_PI426222305 JHI_St_60k_v1 ACGTTGCTGTGTAATGTCGATTGTTCTTTACTTCTTGGATACCACTACAAGTTTTACCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400084511

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400084511 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G18215.1 +1 7e-59 185 87/129 (67%) Protein of unknown function, DUF599 | chr3:6240968-6242358 FORWARD LENGTH=244

Transcript Sequence (407 bp)

>PGSC0003DMT400084511 407 pgsc_dm_v3.4
GAGCTACTGTATGGGAATAAAACATCTATGATGTCTTCTATAAAGTTTTTTACCATCTTG
CTTTGCTTTCTAGTTGCATTTCTCTACAATGTTCAATCTATCAGGTACTACGCTCATGTT
AGCTTCTTAGTTGTTGTGCCTACCTTCAAAGAAAGATCTGATTCTATAGAGTATGTCGCA
AGGAATTTGAACCGAGGGAGCATGTTTTGGTCACTTGGACTACGAGCATTTTATTTGTCA
TTTCCTCTCTTCCTTTGGATATTTGGTCCCATACCGATATTTGTACGTTGCTGTGTAATG
TCGATTGTTCTTTACTTCTTGGATACCACTACAAGTTTTACCAGGGATCTCCACTGTCAA
TCTATAAGAGAGAAAAGAAAGGAAACTGATGTAGATGCGTAAATCAT