Microarray Probes on PGSC0003DMT400084206

Probe IDChipProbe Sequence
CUST_13740_PI426222305 JHI_St_60k_v1 TACCGGGTGTATTGACAGGATCAAAGCAATTTTCATGTGTATCCTGATTGGGCTGCCATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400084206

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400084206 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G46270.1 +2 7e-73 241 179/393 (46%) G-box binding factor 3 | chr2:19000859-19002901 FORWARD LENGTH=382

Transcript Sequence (1828 bp)

>PGSC0003DMT400084206 1828 pgsc_dm_v3.4
GGTGTATTGACAGGATCAAAGCAATTTTCATGTGTATCCTGATTGGGCTGCCATGCAGGC
ATATTATGGTCATCGAGTAGCTGTACCTCCATATGTTAATCCTGCTGTTGCACCTGGTCA
TGCTCCTCATCCTTACATGTGGGGCCCGCTACCGCCTATGATGCCACCTTATGGCACACC
ATATGCAGGAGTCTATGCACATGGTGGTGTTTATCCGCACCCTGGAGTTCCTATTGTGTC
CCGTCCTCAGGCACATGGAATGACATCATCTCCTGCTGTTAGCCAAACCATGAATACTGC
TTCTTTGAGTATGGATGCTTCTGCTAAGTCTTCGGGGAACTCTGATCAAGGCTTGATGAG
TCAGTCAAAAGGGTTTAATGGGCTTGGAATGTCAATTGGAAATTTCACTGTTGACAATGG
TGATGGCACTGACCATGGACCTTCTCAGAGTGGGCAAACTGAAGGTTCAAGTGATGGAAG
TAACATACACACAGCAGAGGTTGGTGAGCACAGGAAGAAAAGAAGCCGCGAGGCAACTCC
TAATAACTCTGGTGACAGAAAAAGTCAAAGACTGTGCAGTCCACAACGTACTAAGGAAGT
AAATGGGGCCTCAGAGAAGGGAATTGGTAATCCTGGTGATATAGCAGAAAAATTAGCGGG
AACAACATTTTCTCCCATCATGACTACTACTCCGCTAGTAAAATCTAGTCCAACTTCACG
AATCAGTCCTGCAGTGCCGGGCGAAGTCTGGTTACAGAATGAACATGAGCTGAAGCGGGA
GAAGAGGAAGCAGTCTAATCGAGAATCTGCAAGGAGATCAAGGTTGAGAAAACAGGCGGA
AGCTGAAGAATTGGCAGTGCGGGTTCAATCTTTAACCTCTGAAAATTTGGCACTCAGATC
AGAAATAAACAAATTCAGCGAACACTCTGAGAAACTAAAGGTTGAAAATGCTGCTTTAAT
GGAGAGACTAAAAAACAAGCTAGGACAAGCAAAAGAGGTAACTTTAGGTATGATTGATGA
TAAGAGGCTGAAGCCTGTTAGCACAGCAGACCTACTAGCAAGAGTCAACAACAACAATGG
TTCATTCAATAGAACCAACGAAGACGGTGAAGTTCATGATAGTACATCTGGAGCAAAGCT
TCGTCAACTCCTTGATGCCAGTCCCAGGACTGATCATGCTGTGGCTGCTAGATGATCATC
GACTAATATTCATGACCGTGGCAGTGTGGTGCCTACTTTGAGATGATAAAAGTAAAAGAA
ATTTAACAGTACAGAGGTGCTGAAGAAATTCTAATTTCGTCTAATTGTAATTTATCCATG
GATGAAGCTGAGGAGTGTGTTTTTGGTCCCTTCACTTCAGAGTGCCACGTTGCATGATGT
CTTATGTAAATTGGTAATGTTAGCCACATTAGAAACTTGACTGATTGAAAAGAGTTTGGC
TTGGATGTGTATGGAGCAGTCAACAAGTGATCTTTGTGATGTATTTGGTGTTTGTTTGTT
AGTTATTAAGCCTTAGCTAGTGCTAAACATATTATCCTTCGTCTCGGGTTCGAGTCCATG
TGTACGGAGTTGCCTTTGTTATGGAGCGCTTTACCCCTCAATGTGGGATCAATGTGAATT
CGGATTTGGTCGGGCTCCAATGGACATGGTATAAGTTAGGTGTAAGATAATTTTGTATTA
GGTTGATTTTAACTCAATCCAATATAGCATATTTTATAAGTGATATCCGAGACAAGTACC
TTTGAACTGTGAAAGTGTTCTCTTCTTGTTCTTTGAATTTGTTCTTGTACAGAGTTGAGT
GTATTTTCTACGACTATATACTTCCTCT