Microarray Probes on PGSC0003DMT400084201

Probe IDChipProbe Sequence
CUST_13799_PI426222305 JHI_St_60k_v1 AAGAAATTACAAAGGAGAAAATGGAGAGCGCATTGAAGGATCTGTCAACTCCCACCGGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400084201

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400084201 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79750.1 +3 0.0 914 451/586 (77%) NADP-malic enzyme 4 | chr1:30007655-30011179 REVERSE LENGTH=646

Transcript Sequence (2136 bp)

>PGSC0003DMT400084201 2136 pgsc_dm_v3.4
AAGACTTGCAGAAAACCCAAAGTCTCTGAATTAAAGAAGATAGATAATAACTTCAAAGGA
GAAAACAAAAGTCTGTGAGAATTTAACAAGAAATTACAAAGGAGAAAATGGAGAGCGCAT
TGAAGGATCTGTCAACTCCCACCGGTGGTGTCGAGGATGTTTACGGTGAGGATTGCGCCA
CTGAGGATCAGTGCATCACTCCCTGGACTATTGCCGTTTCTAGTGGGTACAACTTGTTGA
GGGATCCGCGTTACAACAAAGGGCTTGCCTTCACTGAGAGAGAAAGAGATGCTCATTACT
TGAGAGGCCTTTTGCCTCCTGTCATTTCCTCACAGGAACTTCAGGAGAAAAAACTTATGC
AGTCTATACGCCAATATGACGTCCCTCTGCACAAATATGTTGCCATGATGGAATTAGAGG
AACGAAATGAAAGGTTGTTCTACAAGCTTCTTATTGATAATGTGGAAGAGTTACTTCCAA
TTGTCTACACTCCAACTGTTGGTGAGGCGTGTCAAAAATATGGAAGCATTTTTAAGCGTC
CACAGGGTTTATACATCAGTTTGAATGAAAAAGGAAGGATCCTTGAGGTATTGAAGAACT
GGCCTGAAAAATCTATCCAGGTCATCGTCGTGACTGATGGAGAAAGAATTTTGGGACTTG
GTGACCTTGGCTGCCAGGGAATGGGAATCCCCGTGGGGAAATTAGCCCTGTATACTGCAC
TTGGAGGAGTTAGACCTTCCGCGTGCTTGCCTATTACCATTGACGTAGGGACAAACAATG
AGAAGTTACTGAACGACGAGTTCTACATTGGTCTCAAACAAAGGAGAGCAACTGGACAGG
AATATTATGACTTCCTTCATGAATTCATGTCTGCTGTGAAGCAAAACTATGGCGAAAAAA
TTCTCGTACAGTTTGAAGATTTTGCAAACCACAATGCTTTTGAGCTGTTGGCTAAATATC
GTACCTCGCATTTGGTCTTCAACGATGATATACAGGGGACAGCTTCTGTCGTACTTGCAG
GGCTTATTGCATCCCTTAAGCTACTTGGAGGTGCATTATGTGATCATACATTCTTGTTCC
TCGGTGCTGGAGAGGCTGGGACTGGTATTGCAGAACTCATAGCACTTGAAATTTCAAACA
AGACAAAAATTCCCGTGGAGGAGACACGAAAAAAGATCTGGCTTGTGGACTCAAAGGGTC
TTATTGTTAGTGGTCGCAAGGAAACACTTCAAGCCTTCAAGAAGCCTTGGGCTCATGAAC
ACGAACCTGTCAACAATCTCCTAGACGCTGTTAAGGCCGTTAAGCCAACTGTCTTAATTG
GGACATCTGGAACTGGAAGAACATTTACTAAGGAAGTAGTTGAGGCCATGGCCTGCATGA
ATAAGAGACCTCTTATTATGGCTCTCTCAAACCCAACCTCACAAGCTGAATGTACTGCTG
AAGAAGCTTATACTTGGAGTGAGGGTCGCGTTGTTTTTGCCAGTGGAAGTCCATTCCCTT
CTTTTGAGTACGACGGAAAACTCAACATTCCTGGCCAGGCAAATAACTGTTACATATTCC
CTGGTTTTGGTTTTGGCTTGGTCATGTCTGGTACAATCCGTGTGCACGATGACATGCTTT
TAGCAGCTTCGGAAGCTTTAGCTGCTCAAGTAACTGAGGAACATTATGCCAAGGGAATGA
TATACCCTCCCTTTGCTGATATCCGAAAGATCTCAGCTCACATAGCTGCTAGTGTTGCAG
CCAAAGCATATGAACTTGGTGTGGCAACACGTCTCCCTCAACCTGCAGATTTGGTGAAGT
ATGCTGAGAGTTGCATGTATACTCCTAACTACCGAAGCTACAGATGATTGAATTGATCAT
ATCACCGGTGGTAATCTTGTATGCACCAGAGAGTTGTAATAGTTCGTTTCGATCTGTCTT
TCTTGTAAGCTTGTGTTGTGTATTAAGCTTTATTTTTTGTCGTGACTCGATCAGAAATCG
AGTTTGTTGTTTAGTAAACTTGTTATTGAGTGTGTTGGCATGTTGCCAAAGTAGTTTGTT
TTCATAGCCATAAGAGCTATAATAATTTGAGGAGCCGTGAAGGTGAATAAATTGAGTTGT
TAATGTTATACGGAATTCTATGTTAGTTCTTTGTAT