Microarray Probes on PGSC0003DMT400083776

Probe IDChipProbe Sequence
CUST_24014_PI426222305 JHI_St_60k_v1 GATGGACCCTTGTGTTTCATGCTATTATTGCTGTGTGTGTTGTCTTTATGCTTTTTCTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083776

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083776 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G09460.1 +2 4e-19 90 93/256 (36%) sequence-specific DNA binding transcription factors;transcription regulators | chr5:2944437-2945417 REVERSE LENGTH=326

Transcript Sequence (3099 bp)

>PGSC0003DMT400083776 3099 pgsc_dm_v3.4
AAAAACCGTCGCTGTCTGGTAACTCACAATCTTTTTTCTCTTAAGGATTTTGGTGATATT
ACATTGCAAACTGTTTAGTTGTTCTGGTTCAGGACTTTGATGCATATGCTGCCAAATGTT
TCAGGTGCACTAACTTCCTATTGACAACATACCACGACTGCGAAAACTTCTGTAGCGTAA
AGAAGTAACAATATGCGGTGGCTGAGCCTGTCAATTGATGTGCTTTGTTGCGTCATCCCC
TTGAACTTGTATTGCAGGGTGATCCTTTAAGTCATTTCTCCTATTAAACCAGATTTCTCT
TTTCCCTCACCATTCTCTTCATCTGCCTATCAACTGTAACCAGTTAATTTTGTCTTTTTT
CTTGATAAATCTATAGGATTAGCTGAAAGATAGACAATTGCTAATCAAATTAAGTCCTCT
TAGTCCAGATTTTGATTCGTTTGCACTTTGTCACTGTGCTCATTATTGGTCTTTCAGATT
GCTTTTTTCATACTGCAATTTCCTCAAGCTTCTCCTTTGTTGTAGTCTCCATTTTCCTCC
GAAAGCTAGTACCTATTATTCTTGGGCTTCAGATATTGTCTTTTGGCATAGATTTTGAAT
ATCATTGGAAGGTTGAAAGTAGTTATGGTGTGCCAAGCCGCAAGCCAAACAAGATTTCGG
GCCTTAAAGCATGAGAATGGAATCACGGGGAGAGCAACAATTAGAGTTAGGGTTATAGCA
TGCTTTCAACCATTGCAGAATTGCCAGGTTCGTTCTATATTATTGCCTCACTTATGGATA
ATTACTGTGATATTTAACTGTTGTTTCTCAGTTGTGGGCTTCTATGATGTAATTGAAAAG
CTGCCAAACTTACAGTCTGTTTTTGCTTACCAGGCTGAATACTTCCGTCAGTTGTTGAAG
CCTGTGACGTAGATTCTCTGAGTTCACGCCTTTGTTTTAAATCCAGCTTTATAGTAATTT
CTTGTTATTTGCGTCCTTAAAGTAAATTAAGGTGGAATTTGTACAATCCATATCACTGGT
ATGCATCTAGTCTTTCTGCTGCTATTTCTGTTAAACTTCTGTTGCATTTTGCCTATGGAT
TTCCATCTAATTTCTTACATTATGCATGTTAGGTTTCTCTTCTGTCTAGATGGTTACAAC
CAGCAAGCTCCAATATTACCAGCAGGATCCTGCATGGACTTCACCAAATTTGAATTATGC
CACTACACTCTTGCAACCTGAACATCACCTTGGTGTTCCATCTCTGTATACCCCTGCCAT
ATGTGCTGCAAATGCAGTTTCTCCTAGGCGTTCAAGCTTTGTCCCTTGTTTGCCTAATTC
CAAGGACGCCCGTCACAATGGAGTCAATTGGCTGCCAAACTTAGTTCCCACCAAAAATGA
GTATCCAAGTGATACTAAACGCTTTCTTCCTCACTTGATTGGGTTTAAGTCCCCACCAAC
TGATGCATCTACAAGTTCTCAGAAGAGGTTTCTCATTTGTGATCAATCTGGGAATCAAAC
TAGATTCTTCTTTAGTCAAGGTCGTCCTGCTGAGAATGAAATTATTACACCGAAAGAAGT
GTTTGGTGCTTATGGTTTGCATCAAAATGAGAACCTGAATGTTGTAGTAGAGCAGAGATC
TCATGTGAAGCCCATTATTGGAGAGAAATCGAATGAAAGTTATGTAAATGGTGAAGAAAG
TAATACGCATGAAGATACAGATGACATCAATGCCTTGCTTTTCTCTTCTGATGACATTGA
AGGCGACGAAGATGATGATGTTTATGGTGAGGATGATGAAGTAACTAGCACAGATCGCTC
TCCTTGTGCAAAACAGGGGTGCTGCGGCTGCGGTGAGCATGAGCAACAGTCTGTGGAACT
TACAGAAGAAGTTGCCAGTTCTGATGGCACATGCAAAAGGCTAAGATTGCTAGATGGTGG
GTACAAGAAATCATCATACATAGGATCTAGATGGCCCAATGATGATGTGGAAGCAAGATG
TGTGAGAGGCTCTCTTCCTTCTAGTGGGAAGGATAAGGATTCCAGTTTGAGCACTAGGGA
AAGGAAAGTTAAAATTCGTGAAACCTTGAGGATTCTTGAGAGCTTGATTCCTGGGATAAA
GAGTAAGGACCCGTTGTTGGTTATTGATGTAGCAATCAATTACTTGAAGTCTTTGAGGGG
TAAAGCCGAAGCCTTAGTATCTGAGCTCCCTCAAGAGTATCCCCCAGCCTCTTGTTAAAG
AACAGACTAGTATCCAACCCCTACAACAGTAGCATTATGGATTTTTAGGGGTATAGTTGC
TTGGATAGTACAGAAAAGCCATATATCATTATTTGGTTGAAAGTAGTTAAATTGTGAAGC
ATTTACCATCCTCATCAGTCCTACAGTGCAACAAGTATTATTATCCACTAGAGGAAAAGA
TTTAGTGGGATTCTTTTGATCTTTTACTTGCAAGGGGTAGAACAAAAAGGGGAATGTTTT
TGGTCGACGAGGAATGATTATTTTTAGCTTTTGTGGTTAAGAAAGTAGAATTTCAAAGTT
CAAAAGATGAGTGCTGTAAATGAGGGGGGACCCTTTAAAATCTTGAGAAAACCATGGATT
CTATGCATGCGCATTTGGTGATTTGGGGTCCCACCATCCACCCTATTATGTTTCTTGAAT
TGAATGACTGTATGATGGTTTTCTTTTTGTGGTTGGTTATGTCAGGGTCAGTTTGTGCGA
CTATTTCACTTGGTACTTGCTATCTCCCACCAGCACAGGGTCAGAGTGGCTTGCTATCTC
CCACTGTTATAGGTCAGAATGAGTAGCTATGATGTTTTGATCTTTCTGTTGATTCCACAA
AGGGCATTGGTGTTGAAGAAGGTGCATTGAAAAAGGGGCCCCTTATCATGAAAAGGGTGA
TGGAGAGACATGATCAAATCTTGTCTTAAAGTTAGGTTTGTTTCCACTTTGGATGGGTGA
GTTGTAGTTGGAGACTTGTGAGTCTTTTCAGCGTGGTGTCTTTTTATGAGCCTGATGGAC
CCTTGTGTTTCATGCTATTATTGCTGTGTGTGTTGTCTTTATGCTTTTTCTACTTAAAAT
AATATACTAGTAATAAAATATAGTTTGTTTCGATATTTT