Microarray Probes on PGSC0003DMT400083728

Probe IDChipProbe Sequence
CUST_24064_PI426222305 JHI_St_60k_v1 GATCACCTCGAGGTATAATACATCGATAACGGATACTAGATGGTTGTCTAAAATGTTAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083728

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083728 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G10490.1 +3 1e-32 89 36/63 (57%) 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein | chr4:6483900-6485179 FORWARD LENGTH=348

Transcript Sequence (1747 bp)

>PGSC0003DMT400083728 1747 pgsc_dm_v3.4
ATAAGTGTATATATACATGTCAAGGCCATTGCCATTATTCCTCAACACACATTCAAAAAA
TAAGGTTGCTAGCTACTTATAACATTATGAGAAGCGTGAAATTAGTATCTGAGTTGCCCA
ATTTAAAAGCAGTACCTTGTAATTACTATGTTGATAATCATCATAAATATTCATCACCAG
CCATTATTGACACTAATCATGATGATTCATTAATCCCCATCATTGATTTTTCCCTCCTTT
CCTCAAAAGACCCTCATCAACACTCCAAAGTCATTCAACAACTTGGAAGAGCTTGTCAAC
AATGGGGATTTTTCATGGTTGTGAACCATGGAATAGAAGAAAGTTTGATGAAGGAGTTGA
TTGGGGTGATAAAAGAATTCTTCTTAATGGGAGAGGAGGACAAATGGAGGTACAAAGGGG
AAAAAATGTTTGATCCAATAAAGTATGGAACTAGCTTTAATTATACTTCTAAGGACATCA
CTACTTATTGGAGAGATTACCTTAAACTCTCTCTTCATCCTCAACTTCATTGCCCCGACC
AACCCAATAATTTCAGGTATTTTCTGTCTCTCAATTTGTGTGCTTTTTAACTAATATTTT
AAACTATATAACTTTTTATGATATTAATATGAGATAAATTGCAACTTATTAGTATCTTTT
TCGTATAGTCTTTTGTCAATTTAAATTTGTGAAAGACAATAACAACCGGAAGAATCTTCC
TATGAACTTTGAAAAATCCACATTTTGATATGTGACATGAAACAATCAATGGGTCACTCT
TGTCGGAGTTGGGCCTGTGCGATTGCGACAATTTTATTGGTTCCGAAATCTTCATTAAGC
TAGCTGCTCTTTCAAAAATATTTATATTGGACATATCATAACTTTATATTTTATGTTGTA
TGGTTTAATTTAACAGAGAAGTTTTAGGTGAGTATGGTGAAAAATCGAGAAAAGTGGCAA
GAAAGTTACTATCAGGAATATCAGAAAGCTTAGGATTGGAAGAAGAGTTGATGAACAAAT
CCCTGAATCTGGACTCGGGTTACGAGGTGTTTGTTGCAAATTATTATCCAGCTTGTCCAC
AGCCCGAACTTGTAATGGGCCTTCCACCCCATTCAGATTTTGGCCTTTTAACTTTTCTAA
TACAAAATGATGTTGGAGGATTACAAATACAACACAATGGAAAATGGATCAATATCAATC
CCATTCCCAACTCTATTTTGGTTAACACTGGCGATCACCTCGAGGTATAATACATCGATA
ACGGATACTAGATGGTTGTCTAAAATGTTAATATTTACTATGTGCAATATGATACATCTT
CTTCTTTCTTTTTTTGGGACAGATATTTACGAATGGGAAGTACAAGAGTGTTTTGCACAG
AGCGGTAGTGAACAAAATGGAAAGGATATCAATAGGAATTGCAAATTGCCCAGCTATGAA
TGCCACAGTGAGTCCAGCTGCTTCACCTCTAATCCAAAATGAAAGGTTTCCACCACTCTA
TCTACCCAAGAAATACAGTGAATATGTGGAGATACAGCAGACAAATCCACTTGATGGAAA
GTCATGTTTGGACAGAATCAAGATTAATTCACTACCATTGAAGTAAAAAGAAAAAAAAAA
AAAAGGACTTTATTTCATTTTGTTTCAGTCGACTTGTCTCAAGAAATATGTACTCTCTTT
TTAAATGTATTCATAATTAAATACCAATTTAGCAATAAAAATAAAAAAAAATAAAAAACG
ATTGAGG