Microarray Probes on PGSC0003DMT400083282

Probe IDChipProbe Sequence
CUST_52731_PI426222305 JHI_St_60k_v1 AGATTTCTGCCGACATTGTTGGAATTTGCTTCCTCTTTTCATGATTTTACAGCTGTTAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083282

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083282 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10None-----

Transcript Sequence (468 bp)

>PGSC0003DMT400083282 468 pgsc_dm_v3.4
GGAATTGGTGGAATTGAAGTTACTTGACGGTATTGTCACTATTGTTAGTTAGAAAATGTT
GAAACATCGACTTAGATTTCAAGCACCAAGTTCTGCAATTTTATTGTTCTCCATTTCAAT
TGATCTTGGAGTTTCACTTCATATGTGGAAGTGGAAATTCGAGAAGACACCAACACACCT
CCAAAGAATAAAGAAGGTATCATTGACTGTGAAAAGTCCTACATTTCTGTGTCAGATAAA
GGAACATGGCATGTCCCTTGATAACTCATGTAAAGATTTTACAATAATCTTGTTACGCTT
ATGTGAATTCTCTGACATTAGAGTAATGCACCCGTCGTTTCAATTGTTCTCTGGTGATTT
CTTGAAACAGGAAAAATGCACAAACAAAATTTTCATATTATAAGATTTCTGCCGACATTG
TTGGAATTTGCTTCCTCTTTTCATGATTTTACAGCTGTTAATTCTTGG