Microarray Probes on PGSC0003DMT400083263

Probe IDChipProbe Sequence
CUST_31966_PI426222305 JHI_St_60k_v1 GTTGAAGGTGATTTTTCAGATCCTTGTATAGTCAAAAAGGAAAAGCAAGTCATCAGCAAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083263

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083263 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G55365.1 +1 3e-12 63 25/62 (40%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13500.1); Has 29 Blast hits to 29 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:20673983-20674363 REVERSE LENGTH=126

Transcript Sequence (839 bp)

>PGSC0003DMT400083263 839 pgsc_dm_v3.4
AAAAGACTATTTATTCCACCTGGTGACCCCTTCTCCCACTTTTAGACCAGACAACATTCT
GTTTGGCAGAAAAGTGAAAAAGAAGTGTGAAGAGAAGAATTCAAAGAAAGCAGAAGAAAT
ATGACATTCAATGGGGTATTGGTGGTGTCAGTGGCAAAAGTTTCAGCAGAGATTTGGCAG
CTGCTGGCATGTTTGCCAGAAACAGTAAGCAGTCAGCAACTGTTGGATCTTGTTATCTGT
TATCCTTTTCAACAGATTGGTCGTTTAGCTCTTTGCTTCTGCACTTTCCTCTGTTACCCT
CATAATCTCTATTCCTACCGAAGTTATTCTCATACTACTCCTACCTCATCATCATATCAT
CAAGATTCTTCTGTTTCTTCTTCATCATCTTCTTCGCGTTTGGGACAGAATTGGGTTGAT
TTCGACCTGATAGTCTGATCTCCCTGTAAAGTAACTTCTTTTAAGCATTTGGTTACAAGT
ACTTAACCATCTACAGGAGTTCTAGTTTTATCTAAATGTAAATTGTCCATTTGATTTGAA
CATTTTCCTTTCTTTTCCTCCCCCTTCAAGATGTGGTTGATTCAGTTGTCTGTTCATCAG
TAATGGTTTTGGTGAAATCACTTCTGATTCCATAGCAACTGATGTTGGATCCTTTAGGAT
GATGATACTATTTGGATCATGGGTTTTCCAAGATGTTATTGAGCTTTCCTTGTTATTTTC
TACTGATAAAAGTCCATATTTTAATGGTTCTTGAGCTAGAGTTGAAGGTGATTTTTCAGA
TCCTTGTATAGTCAAAAAGGAAAAGCAAGTCATCAGCAATATTTTTATGGTATGCAGAT